It actually extended from residue 52C75 with a bend of 70 at Thr 69 (Kumaran et al

It actually extended from residue 52C75 with a bend of 70 at Thr 69 (Kumaran et al. et al. 1982), (Hitzeman et al. 1981), (Vallin et al. 2005), (Breitling et al. 1989), (Shi et al. 2007), (Zhang et al. 2010), (Gasmi et al. 2011), Plant nuclear genome (Ohya et al. 2001), Chloroplast (Arlen et al. 2007) and mammalian cells (Rossmann et al. 1996). All host systems have some advantages as well as some limitations. However, the maximum yield (3?g/L) of rhIFN-2b (recombinant human interferon alpha 2b) is reported from up till now (Srivastava et al. 2005). At present, Pakistan imports rhIFN-2b from different countries that cost high for p38gamma the treatment of HCV patients in Pakistan. Keeping in view the cost effective treatment of HCV and poor tolerability, this study was conducted for indigenous production of rhIFN-2b. The gene encoding hIFN-2b from local healthy person was cloned, overexpressed and characterized. The recombinant hIFN-2b was further subjected to the computational analysis to compare our recombinant hIFN-2b with reported hIFN-2b as well as with other members of interferon alpha family. The further experiments are underway to find the binding of rhIFN-2b with its receptor. Materials and methods Cells, vectors and reagents strain DH5, BL21-codon plus and expression vector pET28a(+) were obtained from repository of Institute of Biochemistry and Biotechnology, University of the Punjab, Lahore, Pakistan. Restriction enzymes and DNA polymerase, T4 DNA ligase, AR-9281 RevertAid first strand cDNA synthesis AR-9281 kit, TA cloning kit were purchased from Fermentas Inc. Qiaquick gel extraction kit was purchased from Qiagen (USA), isopropyl–d-1 thiogalactopyranoside (IPTG), 5-bromo-4-chloro-3-indolyl–d-galactopyranoside (X-gal) and all other chemicals required for routine extraction and analysis of biomolecules were purchased from Sigma Aldrich (USA). Primers were synthesized by Gene link (USA). RT-PCR Total RNA was extracted from human AR-9281 leukocytes isolated from the peripheral blood of healthy person by Trizol reagent (Invitrogen, USA). RT-PCR was done using RevertAid first strand cDNA synthesis using oligo(dT)18 as reverse primer. The primers 5 GGACATATGGCCTTGACCTTTGCTTTACT 3 (forward primer), having site (underlined) and 5 GGCGGATCCTCATTCCTTACTTCTTAAAC 3 (reverse primer), having site (underlined) were designed on the basis of reported gene sequence (gi: 209413719). PCR reaction was performed in iCycler (Biorad) using 2?l cDNA solution as template in 50?l reaction volume containing 2.5 units of DNA polymerase, 1 PCR buffer, 200?M each dNTPs, 2?mM MgCl2, 0.5?M of each forward and reverse primer. Thermal cycler was programmed with the following parameters: initial denaturation for 1?minute at 94C followed by 35?cycles of denaturation for 30?seconds at 94C, annealing for 30?seconds at 63C and elongation for 30?seconds at 72C with a final elongation step of 20?minutes at 72C. The amplicon was checked on 1% agarose gel and purified by QIAquick gel extraction kit. Characterization of cloned AR-9281 hIFN-2b The amplified hIFN-2b gene (IAS) was ligated in pTZ57R/T vector. The recombinant vector was designated as pTA-IFN vector and transformed into chemically treated competent cells of strain DH5. Recombinant colonies were selected by blue/white screening (Sambrook and Russell 2001). The clones having recombinant plasmid (pTA-IFN) were confirmed by colony PCR. The positive clones were further confirmed by release of insert (IAS) following digestion with restriction enzymes. The insert IAS was processed further for DNA sequence analysis. For subcloning, the IFN vector was digested with and restriction enzymes and the released 567?bp fragment was purified. The purified fragment was ligated with the pET28a (+) expression vector. The resulting recombinant expression vector (pET-28a-IAS) was used to transform BL21-codon plus competent cells as described in Sambrook and Russell (2001). To select the transformants containing pET-28a-IAS, the cells were grown in plates containing 1% Trypton, 0.5% Yeast extract, 1% Sodium chloride and kanamycin (50?g/ml), pH 7.4 at 37C. The positive clones were further confirmed by colony PCR and digestion with and and further confirmed the cloning of IFN-2b gene (Figure?1)..