[PMC free article] [PubMed] [Google Scholar] Otto, S

[PMC free article] [PubMed] [Google Scholar] Otto, S. also revealed that the anti\proliferative effect of HDACi is independent of REST expression. knockout via CRISPR/Cas9 A CRISPR/Cas9 guide RNA system (OriGene, “type”:”entrez-nucleotide”,”attrs”:”text”:”KN314675″,”term_id”:”705935776″,”term_text”:”KN314675″KN314675) was used to target two different DNA sequences in exon 2 of the gene (“type”:”entrez-nucleotide”,”attrs”:”text”:”NG_029447.1″,”term_id”:”340139043″,”term_text”:”NG_029447.1″NG_029447.1). Two guide sequences (gRNA1: 5\CGCACCTCAGCTTATTATG C\3 and gRNA2: 5\TGGCAAATGTGGCCTTAACT\3) were cloned into the pCas\Guide vector (which includes a Cas9 expression cassette) by OriGene. The constructs pCas\Guide1 (OriGene, KN211570G1), pCas\Guide2 (OriGene, KN211570G2), Rabbit Polyclonal to USP43 and the pCas\Scramble negative control (OriGene, “type”:”entrez-nucleotide”,”attrs”:”text”:”GE100003″,”term_id”:”208302742″,”term_text”:”GE100003″GE100003) were sequenced to confirm the correct insertion sequence. The transfection reactions were performed in 6\well plates (Nunc) seeded with 3.5??104 Daoy cells and cultured in DMEM supplemented with 10% FBS. After 24 h (50C70% confluence), the cells were transfected with one part of pCas\Guide1 plasmids (2?g) suspended in Opti\MEM (Gibco) and three parts (6 l) of Lipofectamine 2000 transfection reagent (Invitrogen). After 4 h, the transfection media was replaced with 2?ml of complete DMEM and the cultures were re\incubated for 48 h. The cells were then Pirmenol hydrochloride plated in a 96\well plate at a cell dilution of 1 1 cell/100 l Pirmenol hydrochloride in order to establish monoclonal cell clones. The monoclonal expansion was evaluated microscopically and screening for the genome editing was performed (cells passage 5) by PCR\amplifying the CRISPR/Cas9 editing site. The products were then sequenced using the DNA Sanger sequencing and the results were compared to the reference human genome. The cells that showed genome editing were propagated for further analysis and the efficiency of knockout was verified by Western blot analysis using anti\REST antibody (1:1000, OriGene, TA330562). 2.5. Knockdown expression using shRNA Two shRNA sequences were designed (shRNA1: 5\AGCTAAAAACAGTGTAATCTACAGTAT CACTTCTCTTGAAAGTGGATACTGTAGATTACACT\3 and shRNA2: 5\GCTAAAAAAGCAGA ATCTGAAGAACAGTTTCTCTTGAAAACTGTTCTTCAGATTCTGCT\3) and cloned into pSUPER\Puro plasmid (Addgene). The constructs were sequenced to confirm their correct insertion and the transfection was performed using Lipofectamine 2000 with 750?ng of the plasmid. After 48 h, the transfected cells were treated with puromycin (Sigma) at a concentration of 5?g/ml until all the non\transfected cells had been killed (10?days). The viable cells from the shRNA1 and two transfections were then plated in 96\well plates (Nunc) at a cell count of Pirmenol hydrochloride 1 1 cell/100?l in order to generate monoclonal cell clones. The monoclonal growth was evaluated microscopically and the screening for the pSUPER genome integration was performed using polymerase chain reactions (PCR). The monoclonal cells with low REST expression were expanded and propagated for further analysis. 2.6. Cell proliferation and sensitivity to HDACi The cells were seeded in 96\well plates at a cell density of 3.5??104 cells/ml and cultured at 37C in 5% CO2. The sensitivity to HDACi was measured by replacing the culture media with complete media containing the required concentration of the inhibitors. The growth and sensitivity to the HDACi were assayed after 24, 48, and 72 h using MTT (3\(4,5\Dimethylthiazol\2\yl)\2,5\Diphenyltetrazolium Bromide) assay. The MTT analyses were performed by replacing the culture media with 50 l of 0.5?mg/ml of MTT reagent (Sigma) prepared Pirmenol hydrochloride in complete culture media and the reaction was incubated at 37C. After 90 min, the MTT solution was replaced with acidified isopropanol (0.04?M HCL) (Sigma), and the MTT absorbance was measured at 590?nm with a reference filter of 720?nm using a spectrophotometer plate reader (FLUOstar Omega, BMG Labtech). 2.7. Wound healing assay The cells were cultured in 6\well plates (Nunc) using complete DMEM culture media at a cell density of 1 1??105 cell/ml and incubated at 37C in 5% CO2. After 24 h the growth was examined under an inverted microscope and the cell monolayer (at 90C100% confluence) was scratched by passing a sterile 200 l pipette tip across the middle of the well in vertical and horizontal directions. The well was then gently washed twice with phosphate\buffered saline (PBS, Oxoid), fed with serum\free media, and imaged at the intersection between the vertical and horizontal scratches. A second image was taken 24 h after wounding and the cell wound closure was analyzed using the TScratch software (CSElab, Zurich, Switzerland) (Geb?ck, Schulz, Koumoutsakos, & Detmar, 2009). 2.8. Cell cycle analysis The cell cycle analysis was performed by harvesting the cells at 80C90% confluence (single\point analysis) and at 24, 48, and 72 Pirmenol hydrochloride h (time courses analysis). The cells were.